Repeated DNA Sequence

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

For example,

Given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT",

Return:
["AAAAACCCCC", "CCCCCAAAAA"].

Solution

class Solution(object):
    def findRepeatedDnaSequences(self, s):
        """
        :type s: str
        :rtype: List[str]
        """
        record, r = set(), set()
        for i in xrange(len(s) - 9):
            substring = s[i:i+10]
            [record, r][substring in record].add(substring)
        return list(r)